
{"id":11975,"date":"2021-11-29T18:45:42","date_gmt":"2021-11-29T23:45:42","guid":{"rendered":"http:\/\/132.236.156.158\/cuccap\/?p=11975"},"modified":"2024-08-07T20:55:41","modified_gmt":"2024-08-08T00:55:41","slug":"squash-team-2021-progress-report","status":"publish","type":"post","link":"http:\/\/132.236.156.158\/cuccap\/2021\/11\/29\/squash-team-2021-progress-report\/","title":{"rendered":"Squash Team | 2021 Progress Report"},"content":{"rendered":"<p>CucCAP researchers and\u00a0<a href=\"http:\/\/132.236.156.158\/cuccap\/about\/partners\/\">stakeholders<\/a> met on October 27, 28 &amp; 29, 2022 to present and discuss the grant\u2019s accomplishments, ongoing research, plans and expectations. View all tables and figures in pages 38 \u2013 47 of the pdf version of this report.<\/p>\n<h2>Team Members<\/h2>\n<ul>\n<li>Michael Mazourek (Cornell University)<\/li>\n<li>Mary Hausbeck (Michigan St University)<\/li>\n<li>Shaker Kousik (USDA-ARS, Charleston)<\/li>\n<li>Geoffrey Meru (University of Florida)<\/li>\n<li>Angela Linares Ramirez (University of Puerto Rico)<\/li>\n<li>Chris Smart (Cornell University)<\/li>\n<\/ul>\n<h3>CucCAP Affiliated Postdocs and Graduate Students<\/h3>\n<ul>\n<li>Gregory Inzinna \u2013 graduate student, Cornell University (Mazourek)<\/li>\n<li>Andrea Landron \u2013 graduate student, University of Puerto Rico (Linares)<\/li>\n<li>Vincent Njung&#8217;e Michael \u2013 graduate student, University of Florida (Meru)<\/li>\n<li>Gregory Vogel \u2013 graduate student Cornell University (Smart)<\/li>\n<\/ul>\n<h2>Objective 2: Map and develop markers for disease resistance<br \/>\nSquash: QTL mapping of resistance to <em>Phytophthora capsici<\/em> in <em>C. pepo<\/em> (GM-UF)<\/h2>\n<h3>Methodology<\/h3>\n<h4>Population development and genotyping<\/h4>\n<p>Resistant breeding line #181761-36P (resistance derived from USDA accession PI 181761) was crossed with a susceptible Acorn-type cultivar, Table Queen to generate F1 seed. A single F1 seed was selfed to generate F2 individuals which were individually selfed to generate F2:3 (n =83) families. DNA from the parents, the F1 and each of the F2 plants was extracted from the leaf tissue using a commercial kit (E.Z.N.A, Omega Biotek). The concentration and quality of the DNA was determined by absorbance measurements (NanoDrop 8000; Thermo Fisher Scientific, Waltham, MA, USA) and agarose gel (0.8% w\/v) electrophoresis. Six hundred and five publicly available SNP markers were selected for genotyping. These SNPs were within genic regions and evenly distributed across the genome. Among these, 83 SNP markers were unsuitable for probe design, thus only 523 markers were genotyped in the parents, F1 and F2 individuals using the targeted genotyping by sequencing platform. Briefly, the <em>C. pepo<\/em> reference genome was used to develop a library of oligo probes (average 60 bp) flanking each SNP of interest. Sequencing libraries (1 \u00d7 75 bp) were prepared and run on a NextSeq 500 Illumina Next Generation Sequencing platform. Sequence reads were mapped onto the <em>C. pepo<\/em> reference genome and SNP calling was performed using standard bioinformatic tools.<\/p>\n<h4>Phenotyping<\/h4>\n<p>Inoculum was prepared from a virulent isolate of <em>P. capsici<\/em> according to the method described by Krasnow et al. (2017). Briefly, 5-mm cornmeal mycelial agar plugs of <em>P. capsici<\/em> were transferred to 14% V8 agar plates (140 mL V8 juice, 3 g CaCO3, 16 g agar per liter) and cultured under constant fluorescent light at 28 \u00b0C. On the 7th day, the plates were flooded with cold sterile distilled water (4 \u00b0C), and chilled at 4 \u00b0C for 30 min prior to incubation at 21\u00b0C for 60 min to allow release of zoospores synchronously. Zoospores in the inoculum suspension were quantified with a hemocytometer and adjusted to 2.0 \u00d7 104 zoospores\/mL. Twelve seeds, each of the F2:3 families (n = 83); 40 seeds of each parent and 10 seeds each of the F1 individuals, were sown in the greenhouse in 4-inch diameter pots filled with sterilized Proline C\/B growing mix (Jolly Gardener, Quakertown, PA, USA) amended with a slow-release fertilizer (14N-4.2P-11.6K). Twelve seeds of the resistant <em>C. moschata<\/em> breeding line #394-1-27-12 were also included in each experiment as checks. The experiment was arranged in an incomplete block design with 10 seeds of both parents included as controls in each block. At the third true-leaf stage, a hand spray bottle adjusted to release 0.5 mL volume per spray was used to deliver 1.5 mL of zoospore suspension at the crown of each plant. Visual recording of disease severity was done every three days from six days post inoculation (dpi) to 28 dpi using a scale of 0 to 5 whereby a rating of 0 was assigned to plants with no symptoms, 1 for plants with a small brown lesion at the base of the stem, 2 for plants with a lesion progressed up to the cotyledons causing constriction at the base, 3 for partially collapsed plants with apparent wilting of leaves, 4 for completely collapsed plants exhibiting severe wilting, and 5 for dead plants. Plants having a score of 1 or less at 28 dpi were classified as resistant, whereas those having a score \u22652 were classified as susceptible. Area Under Disease Progress Curve (AUDPC) values for the F2:3 families were determined using the trapezoidal integration method and used for QTL mapping. The experiment was carried out thrice.<\/p>\n<h4>Linkage mapping and QTL analysis<\/h4>\n<p>A genetic linkage map was constructed with Onemap package in R software with SNP markers polymorphic between the parents. SNP markers with significant segregation distortion from the expected Mendelian segregation (1:2:1) as determined through \u03c7 2 test were excluded. Linkage groups were constructed using the Kosambi mapping function by exploiting recombination fractions. This was done by choosing three initial markers using rapid chain delineation and sequentially adding markers that map with a significant LOD threshold of three. Alternative marker orders were considered with the same LOD threshold before assembling the final linkage map QTL mapping was performed by Haley\u2013Knott linear regression of AUDPC values against genotype probabilities calculated from the linkage map as implemented in the R\/qtl2 package. QTL analysis was conducted independently for each experiment, while joint analysis was conducted using the mean data across experiments. Likelihood-odds (LOD) thresholds set by 1000 permutations (\u03b1 = 0.05) were used to determine the statistical significance of a QTL. Additive and dominance effects, as well as the proportion of total phenotypic variance explained by the QTLs were also estimated. The QTL were visualized using MapChart software.<\/p>\n<h3>Results<\/h3>\n<h4>Phenotypic analysis<\/h4>\n<p>Breeding #181761-36P plants exhibited resistance to Phytophthora crown rot (mean DS = 0.55), whereas the susceptible parent (Table Queen) rapidly succumbed to the pathogen (mean DS = 5) (Figure 1). The resistant check breeding line #394-1-27-12 (<em>C. moschata<\/em>) remained asymptomatic throughout the experiment (mean DS = 0) (Figure 1).<\/p>\n<h4>Figure 1. Resistance to Phytophthora crown rot in breeding line (a) #181761-36P and (b) #394-1-27-12 and susceptibility in (c) Table Queen Acorn-type cultivar.<\/h4>\n<p><strong><a href=\"http:\/\/132.236.156.158\/cuccap\/wp-content\/uploads\/sites\/6\/2021\/12\/CucCAP.compiledrep.2021b.pdf#page=40\" target=\"_blank\" rel=\"noopener noreferrer\">View Figure 1. on page 40 of the PDF version of this report.<\/a><\/strong><\/p>\n<p>AUDPC values for the F2:3 families across the three experiments ranged from 21.18 to 40.69 and displayed a slightly left\u2010skewed normal distribution (Pearson co\u2010 efficient of skewness =\u00a0\u22120.7563) (Figure 2). Transgressive segregation was observed in one direction, with some F2:3 families showing higher susceptibility than the susceptible parent (Figure 2). Significant positive correlations (p &lt; 0.05) were observed for AUDPC values among the three experiments and ranged between 0.57 to 0.65.<\/p>\n<h4>Figure 2. Frequency distribution for disease severity [area under disease progress curve (AUDPC)] in the F2:3 population for experiment 1, experiment 2, experiment 3 and joint analysis (mean across 3 experiments).<\/h4>\n<p><strong><a href=\"http:\/\/132.236.156.158\/cuccap\/wp-content\/uploads\/sites\/6\/2021\/12\/CucCAP.compiledrep.2021b.pdf#page=40\" target=\"_blank\" rel=\"noopener noreferrer\">View Figure 2. on page 40 of the PDF version of this report.<\/a><\/strong><\/p>\n<h3>Linkage mapping and QTL analysis<\/h3>\n<p>SNP Analysis and Map Construction Targeted genotyping by sequencing yielded 24,933,788 reads averaging approximately 129,858 reads per sample, effectively giving a 231\u00d7 coverage for each target SNP. SNP markers that were heterozygous (n = 68) in the parents, monomorphic (n = 182) between the parents or those that deviated (p &lt; 0.00001) from the expected segregation ratio of 1:2:1 (n = 29) was excluded from linkage mapping. The complete genetic map comprised 21 linkage groups encompassing 2068.96cM with a marker density of 8.1 SNP\/cM. QTL analyses with phenotypic data from the three experiments, and from joint analysis, consistently detected a significant QTL (QtlPC-C13) on chromosome 13 (Table 1 and Figure 3). This QTL explained 17.9% to 21.5% of the phenotypic variation observed in F2:3 families, with likelihood-odds values ranging from 3.1 to 5.9 (Table 1). The peak SNP (C002686) for QtlPC-C13 was consistent across the three experiments and the joint analysis. The interval for QtlPC-C13 spanned between 1.07 Mb (Experiment 2) and 1.85 Mb (Joint Analysis) and contained five SNPs (LOD = 3.65 to 5.9)<\/p>\n<h4>Table 1 Linkage group positions (cM) of the QTL associated with resistance to Phytophthora crown rot on chromosome 13 and the corresponding peak SNP positions in the #181761-36P \u00d7 Table Queen F2:3 squash population.<\/h4>\n<h4><strong><a href=\"http:\/\/132.236.156.158\/cuccap\/wp-content\/uploads\/sites\/6\/2021\/12\/CucCAP.compiledrep.2021b.pdf#page=41\" target=\"_blank\" rel=\"noopener noreferrer\">View Table 1. on page 41 of the PDF version of this report.<\/a><\/strong><\/h4>\n<h4>Figure 3 QTL associated with resistance to Phytophthora crown rot on LG (Chr) 13 in #181761-36P. Underlined markers are those within the QTL interval. The significant marker (C002696) is indicated in red font.<\/h4>\n<h4><strong><a href=\"http:\/\/132.236.156.158\/cuccap\/wp-content\/uploads\/sites\/6\/2021\/12\/CucCAP.compiledrep.2021b.pdf#page=41\" target=\"_blank\" rel=\"noopener noreferrer\">View Figure 3. on page 41 of the PDF version of this report.<\/a><\/strong><\/h4>\n<h3>Objective 2.2 Marker development and verification<br \/>\n<em>Phytophthora capsici<\/em> in pepo (GM-UF)<\/h3>\n<h4>Methodology<\/h4>\n<p>Five SNP markers (Table 2) within the confidence interval of the detected QTL (<em>QtlPC-13<\/em>) were converted into Kompetitive allele specific (KASP) PCR assays and genotyped in the F2 population. KASP oligonucleotides were designed using BatchPrimer3 software, and the PCR assays were performed in 10-\u00b5L reactions containing 5-\u00b5L of 2\u00d7 low ROX KASP master mix, 0.16 \u00b5L each of forward primers (10 \u00b5M), 0.41 \u00b5L of reverse primer, 2 \u00b5L of genomic DNA (50 ng\/\u00b5L) and 2.27 \u00b5L of H2O. The PCR conditions consisted of an initial incubation at 94 \u25e6C for 15 min, a touchdown PCR at 94 \u25e6C for 20 s, 61 \u25e6C for 60 s, with a 0.6 \u25e6C decrease per cycle for 10 cycles, followed by 26 cycles of 94 \u25e6C for 20 s and 55 \u25e6C for 60 s. Fluorescent end-point readings and cluster calling were performed using LightCycler\u00ae 480 Instrument II. Marker-trait associations were tested using the Kruskal-Wallis test (p \u2264 0.05) in R statistical software. Candidate genes within the significant QTL interval were identified by scanning the corresponding genomic region for disease resistant homologs using the C. pepo reference genome.<\/p>\n<table class=\"table table-striped table-bordered table-hover table-condensed\">\n<caption>\n<h4>Table 2 Five SNP markers genotyped in the F2 population<\/h4>\n<\/caption>\n<thead>\n<tr>\n<td width=\"60\">\n<h5>SNP<\/h5>\n<\/td>\n<td width=\"66\">\n<h5>SNP Position<\/h5>\n<\/td>\n<td width=\"60\">\n<h5>Reference Allele<\/h5>\n<\/td>\n<td width=\"60\">\n<h5>Alternate Allele<\/h5>\n<\/td>\n<td width=\"84\">\n<h5>KASP Primer<\/h5>\n<\/td>\n<td width=\"641\">\n<h5>Sequence<\/h5>\n<\/td>\n<\/tr>\n<\/thead>\n<tbody>\n<tr>\n<td width=\"60\">C002686<\/td>\n<td width=\"66\">8447660<\/td>\n<td width=\"60\">C<\/td>\n<td width=\"60\">A<\/td>\n<td width=\"84\">C002686_FAM<\/td>\n<td width=\"641\">GAAGGTGACCAAGTTCATGCTCCCAAGTTCTTGAAGAATCTATGAA<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C002686_VIC<\/td>\n<td width=\"641\">GAAGGTCGGAGTCAACGGATTCCCAAGTTCTTGAAGAATCTATGAC<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C002686_R<\/td>\n<td width=\"641\">GGATCAATCCGCTCGATAACCA<\/td>\n<\/tr>\n<tr>\n<td width=\"60\">C009351<\/td>\n<td width=\"66\">7368860<\/td>\n<td width=\"60\">A<\/td>\n<td width=\"60\">G<\/td>\n<td width=\"84\">C009351_FAM<\/td>\n<td width=\"641\">GAAGGTGACCAAGTTCATGCTTTTCCAATCAAGCCAGAACCA<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C009351_VIC<\/td>\n<td width=\"641\">GAAGGTCGGAGTCAACGGATTTTTCCAATCAAGCCAGAACCG<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C009351_R<\/td>\n<td width=\"641\">AACAACTTCAATGGCGCGTC<\/td>\n<\/tr>\n<tr>\n<td width=\"60\">C010730<\/td>\n<td width=\"66\">8697466<\/td>\n<td width=\"60\">C<\/td>\n<td width=\"60\">T<\/td>\n<td width=\"84\">C010730_FAM<\/td>\n<td width=\"641\">GAAGGTGACCAAGTTCATGCTCGTTGATACTGGATTTAACAATGGC<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C010730_VIC<\/td>\n<td width=\"641\">GAAGGTCGGAGTCAACGGATTCGTTGATACTGGATTTAACAATGGT<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C010730_R<\/td>\n<td width=\"641\">CAAGTCTCTCAGCTTCGACCA<\/td>\n<\/tr>\n<tr>\n<td width=\"60\">C011100<\/td>\n<td width=\"66\">9081265<\/td>\n<td width=\"60\">C<\/td>\n<td width=\"60\">T<\/td>\n<td width=\"84\">C011100_FAM<\/td>\n<td width=\"641\">GAAGGTGACCAAGTTCATGCTGCATAACCTTCTTTTAGTTTGTCCAC<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C011100_VIC<\/td>\n<td width=\"641\">GAAGGTCGGAGTCAACGGATTGCATAACCTTCTTTTAGTTTGTCCAT<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C011100_R<\/td>\n<td width=\"641\">CGCTTGAAGCAGAAAGTGGT<\/td>\n<\/tr>\n<tr>\n<td width=\"60\">C030107<\/td>\n<td width=\"66\">8898585<\/td>\n<td width=\"60\">A<\/td>\n<td width=\"60\">G<\/td>\n<td width=\"84\">C030107_FAM<\/td>\n<td width=\"641\">GAAGGTGACCAAGTTCATGCTATCGCCAAAACTGTCCGATTCCA<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C030107_VIC<\/td>\n<td width=\"641\">GAAGGTCGGAGTCAACGGATTATCGCCAAAACTGTCCGATTCCG<\/td>\n<\/tr>\n<tr>\n<td width=\"60\"><\/td>\n<td width=\"66\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"60\"><\/td>\n<td width=\"84\">C030107_R<\/td>\n<td width=\"641\">AGGGGTGATTGTGTTGGTCC<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<h4>Results<\/h4>\n<p>Among the five markers, SNP marker C002686 was significantly associated with resistance to Phytophthora crown rot in the F2:3 population (Kruskal\u2013Wallis rank sum test, p-value = 0.0009528).<\/p>\n<h2>Objective 3. Introgress resistance in advanced breeding lines<\/h2>\n<p>Crosses between #181761-36P and cultivars within various C. pepo market types have been completed. These include: #181761-36P x Zucchini, #181761-36P x Acorn, #181761-36P x Crookneck and #181761-36P x Straightneck. Most of these crosses have been advanced to BC1F1, and are currently undergoing screening in the greenhouse and using marker C002686.<\/p>\n<p><strong>Outcome<\/strong>: Our work on QTL mapping of Phytophthora crown resistance in #181761-36P has recently been published in Plants Journal (MDPI): Michael, V.N.; Fu, Y.; Shrestha, S.; Meru, G. 2021. A Novel QTL for Resistance to Phytophthora Crown Rot in Squash. Plants 10:2115. https:\/\/doi.org\/10.3390\/ plants10102115<\/p>\n<p><strong>QTL for Phytophthora resistance in C. pepo (MM, CS \u2013 CU)<\/strong><\/p>\n<p>Graduate student Greg Vogel combined linkage mapping and bulked segregant analyses for molecular mapping and QTL identification for resistance to the root and crown rot phase of Phytophthora in <em>Cucurbita pepo<\/em>. Through this process, SNPs were identified on five genomic regions (chromosomes 4, 5, 8, 12, and 16). These markers can be used as fixed effect markers in genomic selection or as a preliminary selection criteria when combined with phenotyping.<\/p>\n<h3>Obj. 3.4.1 Introgress, pyramid\/stack resistances into advanced breeding lines \u2013 (MM, CS-CU)<\/h3>\n<p><strong>Fruit Quality Determinations (CS-CU)<\/strong><\/p>\n<p>To determine the quality of newly bred squash cultivars for canning, we have begun experiments in collaboration with the Cornell Food Science Pilot Plant in Geneva NY. In 2021, we grew two industry standard cultivars Golden Delicious (<em>C. maxima<\/em>) and Dickinson (<em>C. moschata<\/em>). The squash will be harvested in the next several weeks (mid-October) and used in a preliminary canning experiment. In 2022, we will grow and can the two industry standard cultivars, Golden Delicious and Dickinson, along with new CucCAP2 cultivars that have been bred for resistance to powdery mildew and Phytophthora. We will then compare these cultivars as they go through the canning process as well as post canning. Texture, color, taste, and ease of canning will all be assessed.<\/p>\n<p><strong>Phytophthora (MM-CU)<\/strong><\/p>\n<p>Poor seed yields from interspecific crosses between \u2018Dickinson\u2019 and \u2018Golden Delicious\u2019 restricted the ability to conduct Phytophthora fruit rot assays. To remedy this we are trying three approaches in parallel. First, rather than rely on hand pollinations, we shifted to bee pollinations of isolated plots. Seed yield improved dramatically from ~10 seed per fruit to ~50 seed per fruit. Interestingly despite being BC1F1, fruit do not resemble the recurrent parent and pumpkin x pumpkin crosses resulted in some elongated butternut fruit shapes.<\/p>\n<h4>Figure #4. Interspecific BC1F1 population (bottom two rows) derived from a cross between \u2018Golden Delicious\u2019 and \u2018Dickinson\u2019 (F1, top) backcrossed to \u2018Golden Delicious\u2019.<\/h4>\n<h4><strong><a href=\"http:\/\/132.236.156.158\/cuccap\/wp-content\/uploads\/sites\/6\/2021\/12\/CucCAP.compiledrep.2021b.pdf#page=44\" target=\"_blank\" rel=\"noopener noreferrer\">View Figure 4. on page 41 of the PDF version of this report.<\/a><\/strong><\/h4>\n<p>Second, we are initiating crosses between \u2018Golden Delicious\u2019 and <em>C. moschata<\/em> from other genetic clades, as an alternative if there may be fertility barriers between the \u2018Dickinson\u2019 clade specifically. While \u2018Dickinson\u2019 is a cultivated processing pumpkin, like \u2018Golden Delicious\u2019, age related Phytophthora fruit rot resistance is common in <em>C. moschata<\/em>. Third, as planned we increased seed from members of each <em>C. maxima<\/em> clade for a structured query into the potential for native genetic resistance to phytophthora fruit rot withing the <em>C. maxima<\/em> species.<\/p>\n<table class=\"table table-striped table-bordered table-hover table-condensed\">\n<thead>\n<tr>\n<td style=\"width: 102px\">\n<h4>PI #<\/h4>\n<\/td>\n<td style=\"width: 192.667px\">\n<h4>Variety Name<\/h4>\n<\/td>\n<td style=\"width: 71.3333px\">\n<h4>Group<\/h4>\n<\/td>\n<\/tr>\n<\/thead>\n<tbody>\n<tr>\n<td style=\"width: 102px\">PI_458702<\/td>\n<td style=\"width: 192.667px\"><em>Plomo ruso (Plaunorskja)<\/em><\/td>\n<td style=\"width: 71.3333px\">1<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_458678<\/td>\n<td style=\"width: 192.667px\"><em>Tanca<\/em><\/td>\n<td style=\"width: 71.3333px\">1<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_458698<\/td>\n<td style=\"width: 192.667px\"><em>Zapallito del Tronco<\/em><\/td>\n<td style=\"width: 71.3333px\">1<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_176527<\/td>\n<td style=\"width: 192.667px\">Kestane<\/td>\n<td style=\"width: 71.3333px\">2<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_135373<\/td>\n<td style=\"width: 192.667px\">No. 5018<\/td>\n<td style=\"width: 71.3333px\">2<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_143274<\/td>\n<td style=\"width: 192.667px\">No. 7488<\/td>\n<td style=\"width: 71.3333px\">2<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_357898<\/td>\n<td style=\"width: 192.667px\">Amzibegovska<\/td>\n<td style=\"width: 71.3333px\">3<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_370452<\/td>\n<td style=\"width: 192.667px\">Golema<\/td>\n<td style=\"width: 71.3333px\">3<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_357915<\/td>\n<td style=\"width: 192.667px\">Ukrasna<\/td>\n<td style=\"width: 71.3333px\">3<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">G_30147<\/td>\n<td style=\"width: 192.667px\">Mayo Blusher<\/td>\n<td style=\"width: 71.3333px\">4<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">G_32612<\/td>\n<td style=\"width: 192.667px\">Crown Squash<\/td>\n<td style=\"width: 71.3333px\">4<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_143284<\/td>\n<td style=\"width: 192.667px\">No. 7735<\/td>\n<td style=\"width: 71.3333px\">4<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">G_23726<\/td>\n<td style=\"width: 192.667px\">Alayo<\/td>\n<td style=\"width: 71.3333px\">5<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_458688<\/td>\n<td style=\"width: 192.667px\"><em>Maguilta<\/em><\/td>\n<td style=\"width: 71.3333px\">5<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_458673<\/td>\n<td style=\"width: 192.667px\"><em>Tabalque<\/em><\/td>\n<td style=\"width: 71.3333px\">5<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_458683<\/td>\n<td style=\"width: 192.667px\"><em>Vistalba<\/em><\/td>\n<td style=\"width: 71.3333px\">5<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_500529<\/td>\n<td style=\"width: 192.667px\">Fipushi<\/td>\n<td style=\"width: 71.3333px\">6<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_500508<\/td>\n<td style=\"width: 192.667px\">ZM-2223<\/td>\n<td style=\"width: 71.3333px\">6<\/td>\n<\/tr>\n<tr>\n<td style=\"width: 102px\">PI_234608<\/td>\n<td style=\"width: 192.667px\">Queensland Blue<\/td>\n<td style=\"width: 71.3333px\">6<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<h3>Powdery mildew (MM-CU)<\/h3>\n<p>The <em>Pm-0 <\/em>allele was transferred to processing pie pumpkin, \u2018Dickinson\u2019. BC3F1 plants were screened for the resistant allele with MAS and the resistant progeny were self-pollinated. Pending greenhouse availability, these will be advanced so BC3F3 seed can be distributed for multiregional resistance testing and canning assays.<\/p>\n<h3>Tropical conditions evaluation (AL-UPR)<\/h3>\n<p>Evaluation of cultivar\/breeding lines resistance to powdery mildew (<em>Podosphaera xanthii<\/em> and <em>Golovinomyces cichoracearum<\/em>) was performed during summer in a randomized complete block design with three repetitions. The plants were sowed on June 9<sup>th<\/sup>, 2021 in the Lajas Experimental Station with a distance of 6 ft. between plants, 10 ft. between rows and 8 ft. between plots. Susceptible genotypes \u2018Taina Dorada\u2019, \u2018Soler\u2019, \u2018Verde Luz\u2019, \u2018Waltham\u2019, \u2018Dickinson\u2019, and tolerant breeding lines 20-1716-05 x 1720-05, 20-1716-02 x 1720, 20-1716-08 x 1720-02 and 20-1716-03 x 1720-02 were evaluated. Variables evaluated were flowering dates, resistance to PM, harvest date, fruit weight (kg) and yield (kg\/ha).<\/p>\n<p>In absence of natural powdery mildew infestation in the field, powdery mildew that was present in the greenhouse in susceptible Waltham genotype was used to inoculate in the field for screening. Infected leaves were cut in squares of 2.54 x 2.54 cm and overlaid on top of young leaves with a paperclip. One leaf per plant was inoculated per plot. The leaves were evaluated 14, 28 and 42 days after inoculation with the following scales:<\/p>\n<ol>\n<li>Number of lesions per leaf<\/li>\n<li>Incidence scale: 0 = without lesions, 1 = from 1-3 lesions, 2 = from 3-5 lesions, 3 = from 5-7 lesions, 4 = from 7-9 lesions, and 5 = more than 9 lesions<\/li>\n<li>Severity scale: 0 = no damage, 1 = chlorosis on top of leaf, 2 = chlorosis and sporulation present on the bottom of the leaf, 3 = sporulation on both sides of the leaf, 4 = necrosis in most part of the leaf, 5 = dead leaf<\/li>\n<\/ol>\n<p>Flowering data on genotypes assessed demonstrate that the \u2018Waltham\u2019 genotype was the first to flower for both male and females (Table 1). Harvest date data shows that 20-1716-05 x 1720-05 and 20-1716-03 x 1720-02 were the first genotypes to be harvested (Table 2). Fruit weight (kg) and yield (kg\/ha) data indicate \u2018Taina Dorada\u2019 genotype had the best performance (Table 2). Since powdery mildew pathogen was not present by natural infestation, and mechanical inoculation was not successful, evaluation for powdery mildew resistance wasn\u2019t possible. However, presence of virus and other fungal pathogens such as <em>Fusarium<\/em> and <em>Alternaria<\/em> were detected.<\/p>\n<h4>Table 1. Flowering data for each genotype<\/h4>\n<h4>Table 2. Harvest date, fruit weight (kg) and yield (kg\/ha) data for each genotype.<\/h4>\n<p><strong><a href=\"http:\/\/132.236.156.158\/cuccap\/wp-content\/uploads\/sites\/6\/2021\/12\/CucCAP.compiledrep.2021b.pdf#page=57\" target=\"_blank\" rel=\"noopener noreferrer\">View images of table 1 &amp; table 2 on page 47 of the PDF version of this report<\/a><\/strong><\/p>\n<p>Given the flowering data, Cornell and temperate varieties seemed to produce and open male flowers earlier than the local or tropical varieties (Table 1). An explanation for this could be that the temperate varieties are under stress because of the change in temperature. In addition,<br \/>\neven when powdery mildew was mechanically inoculated into the field, there was no presence of the pathogen in susceptible \u2018Waltham\u2019 cultivar. This effect indicates that factors such as temperature, humidity and such weren\u2019t favorable for the pathogen to establish and disperse. Moreover, harvest results suggest that genotypes \u2018Taina Dorada\u2019 and \u2018Soler\u2019 produced on average the heaviest fruits for local materials. Meanwhile, \u2018Dickinson\u2019 and 20-1716-02 x 1720 produced the heaviest fruits for temperate materials (Table 2). However, one should consider that even though all cultivars are the same species, different varieties come in variable shapes and sizes. Finally, yield data presented similar results (Table 2). Nevertheless, yield could\u2019ve been severely affected given the abundant presence of fungal and viral pathogens in the field as mentioned previously.<\/p>\n<p>The current summer temperature (20-34 \u00baC) can affect adversely local and temperate pumpkin cultivars by influencing in flowering, harvest (kg) and yield (kg\/ha) given that it is not vegetable season in Puerto Rico. In addition, presence of other fungal and viral pathogens can affect the variables evaluated. Evidently, the temperature recorded in the past summer was not favorable for powdery mildew pathogen for expression in the field. However, one must emphasize that powdery mildew was present in the greenhouse. It is recommended for experiments to be conducted in greenhouse conditions or in the field in alternate seasons for powdery mildew screening in the future.<\/p>\n","protected":false},"excerpt":{"rendered":"<p>View all tables and figures in pages 38 \u2013 47 of the pdf version of this report.<\/p>\n","protected":false},"author":8,"featured_media":0,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"quote","meta":{"footnotes":""},"categories":[268],"tags":[541,472,461,254,470,576,116,216],"_links":{"self":[{"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/posts\/11975"}],"collection":[{"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/users\/8"}],"replies":[{"embeddable":true,"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/comments?post=11975"}],"version-history":[{"count":21,"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/posts\/11975\/revisions"}],"predecessor-version":[{"id":16750,"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/posts\/11975\/revisions\/16750"}],"wp:attachment":[{"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/media?parent=11975"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/categories?post=11975"},{"taxonomy":"post_tag","embeddable":true,"href":"http:\/\/132.236.156.158\/cuccap\/wp-json\/wp\/v2\/tags?post=11975"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}